virus strains neb 5 alpha competent e coli (New England Biolabs)

New England Biolabs is a verified supplier

New England Biolabs manufactures this product

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

New England Biolabs virus strains neb 5 alpha competent e coli
Virus Strains Neb 5 Alpha Competent E Coli, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 3654 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/virus+strains+5+alpha+competent+e+coli/NEB+5/pm41746809-273-145-147
Average 99 stars, based on 3654 article reviews

virus strains neb 5 alpha competent e coli - by Bioz Stars, 2026-10

99/100 stars

Images

Western Blot:

Article Title: Acid-adapted cancer cells alkalinize their cytoplasm by degrading the acid-loading membrane transporter anion exchanger 2, SLC4A2.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit polyclonal anti-AE2 (used for Western Blotting) Novus Biologicals NBP2-15301 Rabbit polyclonal anti-AE2 (used for immunofluorescence) Novus Biologicals NBP2-92513 Rabbit polyclonal anti-SLC4A3 Invitrogen PA5-51351; RRID: AB_2636798 Mouse monoclonal anti-SLC26A3 Santa Cruz sc-376187; RRID: AB_10990725 Mouse monoclonal anti-SLC26A6 Santa Cruz sc-515230 Rabbit polyclonal anti-NDUFS1 Invitrogen PA5-22309; RRID: AB_11151879 Rabbit polyclonal anti-LC3 Invitrogen PA1-16931; RRID: AB_2137583 Mouse monoclonal anti-LAMP2 Santa Cruz Sc-18822; RRID AB_626858 Phospho-mTOR (S2481) Cell signalling #2974P Anti-phospho-S6 (Ser240/244) Cell signalling #5364P Anti-phospho-EIF3 (S422) Cell signalling #3591P Anti-phospho-S6K (T389) Cell signalling #9234P S6K Cell signalling #2708P HRP-conjugated anti-b-actin Proteintech HRP-60008; RRID: AB_2819183 Mouse monoclonal anti-ubiquitin Invitrogen 13-1600; RRID: AB_2533002 Mouse monoclonal anti-EPCAM In-house, Bodmer Lab (Weatherall Institute of Molecular Medicine, University of Oxford) N/A Mouse monoclonal anti-GM130 BD Biosciences 610822; RRID:AB_610822 Goat anti-Mouse IgG (H+L) Highly CrossAdsorbed Secondary Antibody, Alexa FluorTM Plus 555 Invitrogen A32727; RRID:AB_2633276 Goat anti-Rabbit IgG (H+L) Highly CrossAdsorbed Secondary Antibody, Alexa FluorTM Plus 488 Invitrogen A32731; RRID:AB_2633280 Bacterial and virus strains 5-alpha Competent E. coli (High Efficiency) New England Biolabs C2987H Chemicals, peptides and recombinant proteins DMEM Life technologies, 41965-039 Sodium bicarbonate-free DMEM Sigma-Aldrich D7777 Sodium bicarbonate, glucose and phenol red-free DMEM Sigma-Aldrich D5030 Foetal Bovine Serum Merck Life Science F9665-500ML Penicillin-Streptomycin Sigma-Aldrich P0781 Sodium bicarbonate Sigma-Aldrich S5761 Sodium chloride Sigma-Aldrich S5653 Glutamine Sigma-Aldrich G7513 Polybrene Merck Life Science H9268-5G Puromycin Santa Cruz sc-108071A Sulphorhodamine B Sigma-Aldrich 230162-5G Trichloroacetic acid Merck Life Science 91230-100G (Continued on next page) Cell Reports 42, 112601, June 27, 2023 17 .. REAGENT or RESOURCE SOURCE IDENTIFIER Acetic acid Sigma-Aldrich A6283-500ML Tris Base Sigma-Aldrich T1503-1KG Radioimmunoprecipitation assay (RIPA) buffer Cell Signalling 9806S Acrylamide Geneflow Ltd A2-0074 8-Hydroxypyrene-1,3,6-trisulfonic acid trisodium salt (HPTS) Sigma-Aldrich H1529 Tris(bipyridine)ruthenium(II) chloride (RuBPY) Sigma-Aldrich 224758 Sodium pyruvate Gibco 11360-070 Sodium gluconate Sigma-Aldrich 822058 HEPES Sigma-Aldrich H3375 MES Sigma-Aldrich M3671 D-(+)-Glucose Sigma-Aldrich G7021-1KG Hoechst 33342 Invitrogen H3570 5-(and-6)-carboxy SNARF-1 acetoxymethyl ester, acetate Invitrogen C1272 cariporide Tocris 5358 MG-132 Cambridge Biosciences HY-13259-10mg Matrigel Corning 356234 A-485 Tocris 6387 Lysotracker green DND-26 Invitrogen L7526 Bafilomycin A1 Sigma-Aldrich B1793 Glycyl-L-phenylalanine 2- naphthylamide (GPN) Bachem AG K-1325 Chloroquine Alfa Aesar J64459 Rapamycin Cell guidance systems SM83-5 TaqMan master mix Applied Biosystems 4304437 TaqMan probe SLC4A2 Life Technologies 4448489 Taqman probe Actin Applied Biosystems 4333762F Protein A/G magnetic agarose beads Pierce 78609 Cycloheximide Santa Cruz Biotechnology Sc-3508B Critical commercial assays QIAquick Gel Extraction Kit QIAGEN 28706X4 Bicinchoninic acid (BCA) protein assay kit Thermo Fisher Scientific 23225 iScript cDNA Synthesis script Bio-Rad 1708891 RNeasy Kit QIAGEN 74104 Deposited data Supplementary code 1 and 2 This paper Mendeley https://doi.org/10.17632/n8hp45bdrj.1 Supplementary code 3 and 4 This paper Mendeley https://doi.org/10.17632/68crc9wf39.1 Supplementary code 5 This paper Mendeley https://doi.org/10.17632/cw4b9tjygj.1 Experimental models: Cell lines Human: C10 Walter Bodmer’s laboratory (WBL), University of Oxford N/A (Continued on next page) 18 Cell Reports 42, 112601, June 27, 2023

Immunofluorescence:

Virus:

Article Title: Laminin 332-Dependent YAP Dysregulation Depletes Epidermal Stem Cells in Junctional Epidermolysis Bullosa.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Laminin b-3 (6F12) Patricia Rousselle Laboratory, Lyon N/A P63a Di Iorio et al., 2005 N/A YAP1 Merck Cat# MABC203; RRID: AB_11203473 Phospho-YAP (Ser127) Cell Signaling Cat# 4911; RRID: AB_2218913 YAP Cell Signaling Cat# 4912; RRID: AB_2218911 Survivin Abcam Cat# ab469; RRID: AB_304564 TAZ BD PharMingen Cat# 560235; RRID: AB_1645338 P16 (C-20) Santa Cruz Cat# sc-468; RRID: AB_632103 P53 (DO-1) Santa Cruz Cat# sc-126; RRID: AB_628082 Laminin b-3 (C-19) Santa Cruz Cat# sc-7651; RRID: AB_2134210 Integrin beta 1 Abcam Cat# ab52971; RRID: AB_870695 Integrin beta 4 Santa Cruz Cat# sc-135950; RRID: N/A COL7A1 (LH7.2) Santa Cruz Cat# sc-53226; RRID: AB_1121804 14-3-3 sigma (1.N.6) Abcam Cat# ab14123; RRID: AB_300927 alpha 1 Catenin (EP1793Y) Abcam Cat# ab51032; RRID: AB_868700 donkey anti-mouse IgG-HRP Santa Cruz Cat# sc-2314; RRID: AB_641170 donkey anti-rabbit IgG-HRP Santa Cruz Cat# sc-2313; RRID: AB_641181 Donkey anti-Mouse IgG (H+L) Secondary Antibody, Alexa Fluor 568 Thermo Fisher Scientific Cat# A10037; RRID: AB_2534013 Donkey anti-Rabbit IgG (H+L) Secondary Antibody, Alexa Fluor 488 Thermo Fisher Scientific Cat# A-21206; RRID: AB_2535792 Bacterial and Virus Strains 5-alpha Competent E. coli (High Efficiency) New England BioLabs Cat# C2987H Biological Samples Human healthy skin donors for primary keratinocytes and skin sections This manuscript N/A Skin from Junctional Epidermolysis Bullosa Patients for primary keratinocytes and skin sections This manuscript N/A Skin from Dystrophic Epidermolysis Bullosa Patients for primary keratinocytes and skin sections This manuscript N/A Chemicals, Peptides, and Recombinant Proteins DMEM High Glucose EuroClone Cat# ECB7501L Ham’s F-12 Corning Cat# 10-080-CVR Penicillin-Streptomycin Solution 100X EuroClone Cat# ECB3001D L-Glutamine 100X, 200mM EuroClone Cat# ECB3000D Humulin R 100 UI/ml Lilly Cat# HI0210 Adenine Merck Cat# 1152 CAS: 73-24-5 Epidermal Growth Factor H. Recombinant Austral Biologicals Cat# GF-010-8 QD Cholera Toxin List Biological Cat# 9100B Hydrocortisone Acros Cat# AC352450010 CAS: 50-23-7 Liothyronine Sodium (triiodothyronine) Peptido N/A Trypsin-EDTA (0.5%) Life Technologies Cat# 15400054 Fetal Bovine Serum Gamma Irradiated Life Technologies Cat# 10099 (Continued on next page) e1 Cell Reports 27, 2036–2049.e1–e6, May 14, 2019 .. REAGENT or RESOURCE SOURCE IDENTIFIER TaqMan probe CYR61 Hs00998500_g1 Thermo Fisher Scientific Cat# 4331182 TaqMan probe CTGF Hs01026927_g1 Thermo Fisher Scientific Cat# 4331182 TaqMan probe BIRC5 Hs03043576_m1 Thermo Fisher Scientific Cat# 4331182 TaqMan probe ITGA6 Hs01041011_m1 Thermo Fisher Scientific Cat# 4331182 TaqMan probe ITGB1 Hs00559595_m1 Thermo Fisher Scientific Cat# 4331182 Recombinant DNA GIPZ non-silencing Lentiviral shRNA Control Dharmacon Cat# RHS4346 GIPZ Human WWTR1 shRNA #1 Dharmacon Cat# RHS4430-200267049 GIPZ Human WWTR1 shRNA #2 Dharmacon Cat# RHS4430-200268588 TRIPZ Inducible non-silencing Lentiviral shRNA Control Dharmacon Cat# RHS4743 TRIPZ Human YAP1 shRNA #1 Dharmacon Cat# RHS4696-200686207 TRIPZ Human YAP1 shRNA #2 Dharmacon Cat# RHS4696-200707120 pCW57.1-eGFP Laboratory of prof. S. Piccolo N/A pCW57.1-Flag.YAP1 Laboratory of prof. S. Piccolo N/A pCW57.1-Flag.YAP1S127A Laboratory of prof. S. Piccolo N/A pCW57.1-Flag.YAP5SA Laboratory of prof. S. Piccolo N/A pCW57.1-Flag.YAPS94A Laboratory of prof. S. Piccolo N/A Software GraphPad Prism 7 GraphPad https://www.graphpad.com Fiji ImageJ https://fiji.sc Zen 2009 (confocal microscope LSM510meta) Zeiss https://www.zeiss.de AxioVision Rel.

Article Title: Cryo-EM Structure of the Fork Protection Complex Bound to CMG at a Replication Fork
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies a-Csm3 Maric et al., 2014 N/A a-Ctf4 Maric et al., 2014 N/A a-FLAG Sigma Cat# A8592; RRID:AB_439702 a-Mcm7 Maric et al., 2014 N/A a-Mrc1 Mukherjee and Labib, 2019 N/A a-RFA Agrisera Cat# AS07 214; RRID:AB_1031803 a-Psf1 Maric et al., 2014 N/A Bacterial and Virus Strains 5-alpha Competent E. coli (High Efficiency) New England Biolabs Cat# C2987H Escherichia coli: Rosetta 2(DE3) strain: F- ompT hsdSB(rB - mB -) gal dcm (DE3) pRARE2 (CamR) Novagen / Merck Millipore Cat# 71400 Chemicals, Peptides, and Recombinant Proteins 3X FLAG peptide Sigma Cat# F4799 Adenosine 50-(b,g-imido)triphosphate lithium salt hydrate (AMP-PNP) Sigma Cat# A2647 dNTP set Invitrogen Cat# 10297018 NTP set Invitrogen Cat# R0481 [alpha-P32]dCTP Hatmann analytic Cat# SRP-205 Anti-FLAG M2 affinity gel Sigma Cat# A2220 Bio-Gel HT (Hydrated) Hydroxyapatite Bio-Rad Cat# 130-0150 Calmodulin-Sepharose 4B GE Healthcare Cat# 17-0529-01 Camptothecin, Camptotheca acuminata Merck Cat# 208925 cOmplete, EDTA-free Roche Cat# 5056489001 Disuccinimidyl dibutyric urea (DSBU) ThermoScientific Cat# A35459 Glutaraldehyde Sigma Cat# G5882 Nonidet P-40 substitute (NP-40-S) Roche Cat# 11754599001 Glutathione Sepharose 4B GE Healthcare Cat# 17-0756-01 HiTrap Blue HP GE Healthcare Cat# 17-0412-01 HiTrap DEAE Fast Flow GE Healthcare Cat# 17-5055-01 HiTrap Heparin HP GE Healthcare Cat# 17-0406-01 HiTrap SP HP GE Healthcare Cat# 29-0513-24 IgG Sepharose Fast Flow GE Healthcare Cat# 17-0969-01 Micro SpinColumn, C18 column Harvard Apparatus Cat# 74-4607 MonoQ PC 1.6/5 GE Healthcare Cat# 17-0671-01 MonoQ 5/50 GL GE Healthcare Cat# 17-5166-01 MonoS 5/50 GL GE Healthcare Cat# 17-5168-01 Ni-NTA Agarose QIAGEN Cat# 30210 Phosbind acrylamide APExBIO Cat# F4002 SephacrylTM S400 High Resolution GE Healthcare Cat# GE27-5330-02 Suberic acid bis(3-sulfo-N-hydroxysuccinimide ester) sodium salt (BS3) Sigma Cat# S5799 Superdex 200 Increase 10/300 GL GE Healthcare Cat# 28-9909-44 SuperoseTM 6 Increase 10/300 GL GE Healthcare Cat# 29-0915-96 (Continued on next page) Molecular Cell 78, 926–940.e1–e13, June 4, 2020 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER TWEEN 20 (used for buffer exchange prior to cryo-EM grid preparation) Sigma Cat# P8341 Microspin G-50 columns GE Healthcare Cat# GE27-5330-02 Recombinant Proteins (see also Table S5) Cdt1-Mcm2-7 Coster et al., 2014 N/A ORC Frigola et al., 2013 N/A Cdc6 Frigola et al., 2013 N/A DDK On et al., 2014 N/A Sld3/7 Yeeles et al., 2015 N/A Cdc45 Yeeles et al., 2015 N/A Dpb11 Yeeles et al., 2015 N/A Sld2 Yeeles et al., 2015 N/A GINS Yeeles et al., 2015 N/A Pol ε Yeeles et al., 2015 N/A S-CDK Yeeles et al., 2015 N/A Mcm10 Yeeles et al., 2015 N/A Pol a Yeeles et al., 2015 N/A Ctf4 Yeeles et al., 2015 N/A RPA This study N/A Mrc1 This study N/A Csm3/Tof1 This study N/A RFC Yeeles et al., 2017 N/A PCNA Yeeles et al., 2017 N/A Pol d Yeeles et al., 2017 N/A Fob1 This study N/A Csm3-2A/Tof1 This study N/A Csm3-5A/Tof1 This study N/A Csm3/Tof1-3A This study N/A Csm3-2A/Tof1-3A This study N/A Csm3-5A/Tof1-3A This study N/A Lambda phosphatase He Laboratory N/A Bovine Serum Albumin Invitrogen Cat# AM2616 Deposited Data Co-ordinate file for conformation 1 (CMG-Csm3Tof1-Ctf43-fork DNA, reconstituted sample) This study PDB: 6SKL Co-ordinate file for conformation 2 (MCM C-TierssDNA, reconstituted sample) This study PDB: 6SKO Map of conformation 1 (CMG-Csm3-Tof1-Ctf4fork DNA, reconstituted sample) This study EMDB: EMD-10227 Map of conformation 2 (multi-body refinement of MCM[C-tier], reconstituted sample) This study EMDB: EMD-10230 Map used in building Csm3-Tof1 atomic model (multi-body refinement of Csm3-Tof1[body]Mcm467[NTier], reconstituted sample) This study EMDB: EMD-10507 Map used in building Csm3-Tof1 atomic model (multi-body refinement of Tof1[head]Mcm235[NTier], reconstituted sample) This study EMDB: EMD-10508 Map of conformation 1 (multi-body refinement of Cdc45-GINS-Ctf4, reconstituted sample) This study EMDB: EMD-10509 (Continued on next page) ll Article e2 Molecular Cell 78, 926–940.e1–e13, June 4, 2020

Article Title: U1 snRNP regulates alternative promoter activity by inhibiting premature polyadenylation.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-Rpb1 CTD (for total RNAPII) Cell Signaling Cat#2629; RRID: AB_2167468 Rabbit anti-RNAPII CTD repeat YSPTSPS (phosphor S2) Abcam Cat#ab238146 Rabbit anti-Phospho-Rpb1 CTD (Ser5) Cell Signaling Cat#13523; RRID: AB_2798246 Rabbit anti-Histone H3K4me3 Active motif Cat39060; RRID: AB_2615077 Bacterial and virus strains 5-alpha Competent E.coli (High Efficiency) New England Biolab Cat#C2987H Chemicals, peptides, and recombinant proteins TRIzol® Reagent Thermo Scientific Cat#15596026 Lipofectamine3000 Invitrogen Cat#L3000008 4-thiouridine (4SU) Sigma-Aldrich Cat#T4509 4-thiouracil (4TU) Sigma-Aldrich Cat#440736 MTSEA biotin-XX linker Biotium Cat#BT90066 DTT Sigma-Aldrich Cat#10197777001 Lyticase Sigma-Aldrich Cat#L2524 Streptavidin MicroBeads Miltenyi Biotec Cat#130-048-101 Chloroform/isoamyl alcohol Sigma-Aldrich Cat#C0549 L-glutamine (100x) Thermo Scientific Cat#MT25005CI Spermidine trihydrochloride Sigma-Aldrich Cat#S2501-5G Digitonin Sigma-Aldrich Cat#300410-1G cOmplete EDTA-free tablets Sigma-Aldrich Cat#04-693-132-001 Concanavalin A Magnetic Beads Bangs Laboratories Cat#B P531 Cutana PAG-Mnase Epicypher Cat#15-1016 Tagment DNA Enzyme (TDE1) Illumina Cat#20034197 NP-40 10% Sigma-Aldrich Cat#11332473001 Tween-20 10% Sigma-Aldrich Cat#11332465001 UltraPureTM Phenol:Chloroform:Isoamyl Alcohol Invitrogen Cat# 15593-031 AmPure XP Beads BECKMAN COULTER Cat# A63881 Critical commercial assays RNeasy Mini Kit QIAGEN Cat#74104 Monarch PCR&DNA cleanup kit New England Biolabs Cat#T1030L KAPA RNA HyperPrep Kit with RiboErase KAPA Biosystems Cat#KR1351 KAPA-Unique Dual-indexed Adapter Kit KAPA Biosystems Cat#KR1736 Maxima H Minus cDNA Synthesis Kit Thermo Scientific Cat#K1652 GeneJET Genomic DNA Purification Ki Thermo Scientific Cat#K0722 Agilent RNA 6000 Pico Agilent Technologies Cat#5067-1513 Agilent High Sensitivity DNA Kit Agilent Technologies Cat#5067-4626 Chromatin Accessibility Assay Kit Abcam Cat# ab185901 Luna® Universal qPCR kit New England Biolabs Cat#M3003L Qubit 1x dsDNA HS Assay Kit Invitrogen Cat# Q33231 CUTANATM ChIC/CUT&RUN Kit EpiCypher Cat# 14-1048 CUTANATM CUT&RUN Library Prep Kit EpiCypher Cat# 14-1002 GeneJET Plasmid Miniprep Kit Thermo Scientific Cat# K0502 PureLink Endotoxin-Free Maxi Plasmid Purification kit Invitrogen Cat# A31217 (Continued on next page) e1 Molecular Cell 85, 1968–1981.e1–e7, May 15, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Gibson Assembly® Master Mix New England Biolabs Cat# E2611L PhusionTM Site-Directed Mutagenesis Kit Thermo Scientific Cat# F541 Deposited data RNA-seq, TT-seq, CUT&RUN-seq, ATAC-seq, and PRO-seq after U1 snRNP ASO treatment This paper GEO: GSE252392 Nascent RNA-seq and 3’Poly(A)-seq after 8h of U1 AMO treatment Oh et al.23 GEO: GSE103252 Mouse Embryonic Stem Cells RNA-seq, PRO-seq, and TT-seq Mimoso and Adelman19 GEO: GSE218135 Rat granule RNA-seq Xu et al.72 GEO: GSE101917 Drosophila melanogaster S2 cell line RNA-seq Eleazer et al.73 GEO: GSE225445 Zebrafish gonads RNA-seq Lorenzo-Orts et al.74 GEO: GSE241537 FUS knockdown RNA-seq De Santis et al.75 GEO: GSE94888 Experimental models: Cell lines HeLa ATCC N/A HeLa-A12 Khandelia et al.50 N/A Oligonucleotides Negative Control ASO (CCTCTTACCTC AGTTACAATTTATA) Gene Tools, LLC N/A U1 ASO (GGTATCTCCCCTGCCAGGTAAGTAT) Kaida et al.21 Gene Tools, LLC N/A PCR primers This Paper Table S1 Recombinant DNA pEGFP_empty Addgene Cat#82369 pU1_U1 snRNA_CMV_EGFP This Paper N/A pU1_SPG7-specific-U1 snRNA_CMV_EGFP This Paper N/A pLoxP Khandelia et al.50 N/A pLoxP-MYADM This Paper N/A pLoxP-MYADMp1-SPG7PA-MYADMp2 This Paper N/A pLoxP-MYADMp1-SV40PA-MYADMp2 This Paper N/A pCRE Khandelia et al.50 N/A pCas9-GFP Addgene Cat#48138 pCas9-mCherry Addgene Cat#64324 pU6-sgRNA-dCas9-EGFP Addgene Cat#159086 Software and algorithms STAR 2.7.9a Dobin et al.76 N/A Samtools 1.12 Li et al.77 N/A Bedtools 2.31.0 Quinlan and Hall78 N/A HITindex Fiszbein et al.38 N/A Python3/3.8.6 https://www.python.org/ N/A Trimmomatic 0.39 Bolger et al.79 N/A Cutadapt 2.10 Martin80 N/A Kallisto 0.43.0 Bray et al.81 N/A Salmon 1.1.0 Patro et al.82 N/A R 4.2.3 https://www.r-project.org/ N/A Rstudio https://www.rstudio.com/ N/A DESeq2 Love et al.83 N/A Prism8 GraphPad N/A iProEP Lai et al.39 N/A MACS2/2.1.2.1 Zhang et al.84 N/A (Continued on next page) Molecular Cell 85, 1968–1981.e1–e7, May 15, 2025 e2

Article Title: Dynamic IL-6R/STAT3 signaling leads to heterogeneity of metabolic phenotype in pancreatic ductal adenocarcinoma cells
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Radioimmunoprecipitation assay (RIPA) buffer Cell Signaling 9806S Recombinant Human IL-6 R alpha/IL-6 Protein Chimera Bio-Techne 8954-SR-025 Recombinant IL6 Cambridge Bioscience 009-001-310 RPMI Merck Life Science R0883 Sodium bicarbonate, glucose and phenol red-free DMEM Sigma-Aldrich D5030 Sodium bicarbonate Sigma-Aldrich S5761 Sodium bicarbonate-free DMEM Sigma-Aldrich D7777 Sodium chloride Sigma-Aldrich S5653 Sodium pyruvate Gibco 11360–070 Sulphorhodamine B Sigma-Aldrich 230162-5G Trichloroacetic acid (TCA) Merck Life Science 91230-100G Tris Base Sigma-Aldrich T1503 Tris(bipyridine)ruthenium(II) chloride (RuBPY) Sigma-Aldrich 224758 Critical commercial assays Bicinchoninic acid (BCA) protein assay kit Thermo Fisher Scientific 23225 iScript cDNA Synthesis script Bio-Rad 1708891 QIAquick Gel Extraction Kit QIAGEN 28706X4 qRT-PCR Brilliant III SYBR Master Mix Agilent 600886 RNeasy Micro Kit QIAGEN 74004 TMB ELISA substrate Abcam ab171522 Stop Solution for TMB Substrate Abcam ab171529 Deposited data Results of RNAseq analysis GEO accession viewer https://www.ncbi.nlm.nih.gov/geo/ GSE228611 Experimental models: Cell lines Human AsPC1 Prof. Anna Trauzold, University of Kiel, Germany N/A Human BxPC3 Prof. Anna Trauzold, University of Kiel, Germany N/A Human Colo-357 Prof. Anna Trauzold, University of Kiel, Germany N/A Human HPAC ATCC CRL-2119 Human: MIA Pa-Ca-2 Prof. Alessandra Fiorio, University of Lille, France N/A Human PANC-1 Prof. Anna Trauzold, University of Kiel, Germany N/A Experimental models: Organisms/Strains Female athymic Nude Crl:NU(NCr)-Foxn1nu mice Charles River N/A Oligonucleotides IL-6R siRNA Santa Cruz sc-35663 LentiCRISPR sgSOCS3 GATGTAATAGGCTCTTCTGG Sigma-Aldrich N/A LentiCRISPR sgSOCS3 TGAGCGTGAAGAAGTGGCGC Sigma-Aldrich N/A siGENOME siControl Dharmacon D-001210-01-05 siGENOME SOCS3 Dharmacon M-004299-02-0005 SOCS3 siRNA Santa Cruz SC-41000 STAT3 siRNA Santa Cruz sc-29493 (Continued on next page) 18 Cell Reports 43, 113612, January 23, 2024 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains 5-alpha Competent E. coli (High Efficiency) New England Biolabs C2987H Premo FUCCI Cell Cycle Sensor (BacMam 2.0) Life Technologies P36238 Recombinant DNA Laconic/pcDNA3.1( ) San Martin et al., 201325 Addgene: 44238 lentiCRISPR v2 Sanjana et al., 201449 Addgene: 52961 lentiCRISPR constructs with gRNA insert listed above This paper N/A Software and algorithms Fiji ImageJ N/A Gen5 v.10 Biotek N/A MATLAB R2020b Mathworks N/A Singscore R package Foroutan et al., 201850 N/A Article ll OPEN ACCESS ..

Article Title: Dynamic IL-6R/STAT3 signaling leads to heterogeneity of metabolic phenotype in pancreatic ductal adenocarcinoma cells.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains 5-alpha Competent E. coli (High Efficiency) New England Biolabs C2987H Premo FUCCI Cell Cycle Sensor (BacMam 2.0) Life Technologies P36238 Recombinant DNA Laconic/pcDNA3.1( ) San Martin et al., 201325 Addgene: 44238 lentiCRISPR v2 Sanjana et al., 201449 Addgene: 52961 lentiCRISPR constructs with gRNA insert listed above This paper N/A Software and algorithms Fiji ImageJ N/A Gen5 v.10 Biotek N/A MATLAB R2020b Mathworks N/A Singscore R package Foroutan et al., 201850 N/A Cell Reports 43, 113612, January 23, 2024 19 ..

Article Title: Multi-level functional genomics reveals molecular and cellular oncogenicity of patient-based 3' untranslated region mutations.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit anti-ZWILCH Abcam 202898 Mouse anti-NCL Abcam 136649 Rabbit anti-IGF1R Cell Signaling 3027; RRID:AB_2122378 Rabbit anti-AUF1 Cell Signaling 12382; RRID:AB_2616009 Rabbit anti-KHSRP Cell Signaling 5398; RRID:AB_10694649 Rabbit anti-TIAL1 Cell Signaling 5137; RRID:AB_1904169 Rabbit anti-ELAVL1 Cell Signaling 12582; RRID:AB_2797964 Goat anti-mouse Invitrogen 31430 Goat anti-rabbit Invitrogen 31460 Mouse anti-b-Actin Sigma A5316; RRID:AB_476743 Bacterial and virus strains 5-alpha Competent E. coli (High Efficiency) NEB C2987I Stellar Electrocompetent Cells Takara 636765 Chemicals, peptides, and recombinant proteins AMPure XP for PCR Purification Beckman Coulter A63880 HyClone Fetal Bovine Serum Cytiva SH30396.03 Charcoal:Dextran Stripped Fetal Bovine Serum Gemini Bio-Products 100–119 Lipofectamine MessengerMAX Invitrogen LMRNA003 Lipofectamine RNAiMAX Invitrogen 13778030 Lipofectamine 3000 Invitrogen L3000008 SUPERase-In RNase Inhibitor Invitrogen AM2696 TRIzol Reagent Invitrogen 15596–018 TURBO DNase Invitrogen AM2238 Actinomycin D MP Biomedicals 02104658-CF DpnI NEB R0176 FseI NEB R0588S T4 DNA Ligase (2,000,000 U/mL) NEB M0202T .. Fugene HD Promega E2311 Phase Lock Gel Tube- Heavy QuantaBio 10847–802 Romidepsin (FK228, Depsipeptide) Selleckchem S3020 Cisplatin Sigma Aldrich P4394-25MG Cycloheximide Sigma Aldrich C7698 DTT Sigma Aldrich 43815 Critical commercial assays iScript Reverse Transcription Supermix Bio-Rad 1708841 iScript gDNA Clear cDNA Synthesis Kit Bio-Rad 1725035 SsoAdvanced Universal SYBR Green Supermix Bio-Rad 172–5272 MAXIscript T7 Transcription Kit Invitrogen AM1312 mMESSAGE mMACHINE T7 ULTRA Transcription Kit Invitrogen AM1345 PureLinkTM HiPure Plasmid Filter Maxiprep Kit Invitrogen K210016 SuperScript III First-Strand Synthesis System Invitrogen 18080–051 NucleoSpin Gel and PCR Clean-up Kit Macherey-Nagel 740609.5 (Continued on next page) 18 Cell Reports 42, 112840, August 29, 2023

Recombinant:

Irradiation:

Magnetic Beads:

Polymerase Chain Reaction:

cDNA Synthesis:

DNA Purification:

Real-time Polymerase Chain Reaction:

Plasmid Preparation:

Purification:

other:

Article Title: TopBP1 assembles nuclear condensates to switch on ATR signaling.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Adenosine 50-triphosphate disodium salt hydrate Sigma-Aldrich Cat# A7699; CAS:34369-07-8 Creatine kinase Sigma-Aldrich Cat# C9858; MDL: MFCD00151687 Phosphocreatine di(tris) salt Sigma-Aldrich Cat# P1937; CAS: 108321-17-1 5-Iodo-20-deoxyuridine Sigma-Aldrich Cat# I7125; CAS: 54-42-2 5-Chloro-20-deoxyuridine Sigma-Aldrich Cat# C6891; CAS: 50-90-8 ATR Inhibitor III, ETP-46464 Merck Cat# 5005080001; CAS: 1345675-02-7 VE-821 TINIB-TOOLS Cat# V134; CAS: 1232410-49-9 UCN-01 Sigma-Aldrich Cat# U6508; CAS: 112953-11-4 Streptavidin-Agarose Sigma-Aldrich Cat# S1638; MDL: MCFD00082035 Dulbecco’s Modified Eagle’s Medium - high glucose Sigma-Aldrich Cat# D5796 McCoy’s 5A Medium Sigma-Aldrich Cat# M9309; MDL: MFCD00217560 EX-CELL 420 Serum-Free Medium for Insect Cells Sigma-Aldrich Cat# 14420c; MDL: MFCD01634638 BioWest - Fetal Bovine Serum Eurobio Scientific Cat# S1810 Critical commercial assays Quick Start Bradford 1x Dye Reagent Bio-Rad Cat# 500-0205 Clarity western ECL substrate Bio-Rad Cat# 170-5061 Clarity max western ECL substrate Bio-Rad Cat# 1705062 Criterion TGX stain free gel 7,5% Bio-Rad Cat# 5678024 Criterion TGX stain free gel 4-15% Bio-Rad Cat# 5678084 Criterion TGX stain free gel 10% Bio-Rad Cat# 5671034 Mini-PROTEAN TGX Stain Free Gels, 7.5% Bio-Rad Cat# 4568023 Mini-PROTEAN TGX Stain Free Gels, 4-15% Bio-Rad Cat# 4568083 Mini-PROTEAN TGX Stain Free Gels, 10% Bio-Rad Cat# 4568033 Trans-Blot Turbo Transfer Pack 0,2 mm Nitrocellulose Midi, 10 pack Bio-Rad Cat# 1704159 Trans-Blot Turbo Transfer Pack 0,2 mm Nitrocellulose Mini, 10 pack Bio-Rad Cat# 1704158 Color Prestained Protein Standard, Broad Range BioLAbs Cat# P7712S HisTrap HP column GE Healthcare Cat# 71-5027-68 AF HiTrapTM Desalting column GE Healthcare Cat# 71-7154-00 AM HiPrep 26/10 GE Healthcare Cat# 28-4026-52 AB Cellfectin ThermoFisher Scientific Cat# P/N 58760 Lipofectamine 2000 ThermoFisher Scientific Cat# 11668-019 SnakeSkin Dialysis Tubing Thermo Fisher Scientific Cat# 68700 Precission 3C GenScript Cat# Z03092-500 Deposited data Raw and analyzed data This paper https://dx.doi.org/10.17632/6nf7b7ffb7.1 Experimental models: cell lines Flp-In T-REx 293 Invitrogen Cat# R78007; RRID:CVCL_U427 RPE1 HTRT Gift from Dr. Krzysztof Rogowski N/A U2OS Gift from Dr. Mikko Sokka N/A HeLa S3 ATCC Cat# CCL-2.2; RRID:CVCL_0058 Sf9 Insect Cells - Novagen Sigma-Aldrich Cat# 71104-M (Continued on next page) Molecular Cell 81, 1231–1245.e1–e8, March 18, 2021 e2

Review